MUC1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
MUC1 CRISPR
MUC1 Lentiviral
MUC1 AAV
MUC1 Adenovirus
MUC1 ORF
MUC1 siRNA
-
Retired Cat.No.
31126111 -
Product Name
MUC1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human) -
Unit
3 x 1.0 µg DNA -
Description
abm's Knockout sgRNA vectors and viruses are ready to use in your CRISPR Gene Knockout experiment. These vector and virus products come as a set of three sgRNA targets which are designed to guide Cas9 to cleave exonic gDNA resulting in frameshift mutations and ultimately gene knockout. Available constructs include All-in-One (Cas9 and sgRNA expression) and sgRNA only (no Cas9 expression) – navigate to Custom Option to select the latter. Our CRISPR vectors and viruses are also available in a variety of formats including Lentivirus, AAV and Non-Viral.
Save 30% OFF Packaging Mix or Transduction Enhancer with any lentivector or lentivirus. Click here to claim your savings! -
Gene Name/Gene ID
MUC1, 4582 -
Gene Full Name
mucin 1, cell surface associated -
Alias
CD227, PEM -
Accession Number
-
Species
Human -
System
Lentiviral Vector -
Target Sequence
191 CTGCAGCTCTTGGTAGTAGT
389 GATCGTCAGGTTATATCGAG
561 GCTGCCCGTAGTTCTTTCGG -
Promoter
SFFV-U6 -
Storage Condition
Store Lentiviral Vectors at -20°C. -
QC
Restriction Enzyme Digest and Sequencing -
Disclaimer
-
Guarantee
abm guarantees that at least one out of the three sgRNA Lentiviral constructs purchased in a set designed to be used with Cas9 Nuclease will result in complete gene knockout (due to indel) in over 50% of cells at 1 week after successful transduction and drug selection. Click for more info☛ View our CRISPR Workflow Guide to learn how to use our CRISPR KO products and identify key stages in delivery, selection, and screening.
-
Caution
This product is for research use only and is not intended for therapeutic or diagnostic applications. Please contact a technical service representative for more information.
Print/Download Datasheet
Publishing research using LG131126? Please let us know so that we can cite the reference in this datasheet.
LG131126 has not been cited in any literature.
Question
ABM community
Verified customer
Asked on Jan 30 2026
Answer
The lentivirus should be aliquoted into smaller working volumes and then stored at -80°C. Lentivirus is sensitive to storage temperature and to freeze/thaws. It can lose up to 5% or more activity with each freeze/thaw. When stored properly, viral stocks of an appropriate titer should be suitable for use for up to one year. After long-term storage, we recommend re-titering your viral stocks before use.
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Jan 30 2026
Answer
abm lentiviral transfer vectors use the third generation lentivirus system. It is based on the inactivated HIV genome. Note that our lentivirus packaging plasmids cannot be integrated into the host and are transiently expressed.
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Jan 30 2026
Answer
MOI (Multiplicity of Infection) refers to the number of viral particles per cell used in the infection, e.g. an MOI of 5 indicates that there are five infectious units (IU) or transducing units (TU) for every cell. MOI is determined by calculating the numbers of viral particles added per well then divide this number by the number of cells seeded into the well. We also recommend transducing the cells with a range of MOIs as different cell types may require different MOIs for successful transduction.
MOI = Product Titer (IU/ml) x Virus Volume (ml) / Total Cell Number
MOI = Product Titer (IU/ml) x Virus Volume (ml) / Total Cell Number
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Jan 30 2026
Answer
The concentration must be optimized for each cell type. Typical selection amounts are around 0.1 - 0.5µg per ml.
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Mar 24 2025
Answer
Yes.
ABM Scientific Support
Answered on Mar 24 2025
ABM community
Verified customer
Asked on Jan 30 2026
Answer
Optimal cell density for lentiviral transduction is generally 50-70% confluent for most cell types. Certain cell lines may require the optimal cell density to be determined experimentally.
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Jan 30 2026
Answer
These are medium-high copy plasmids and should be propagated in a cloning E. coli strain such as DH5α. Typical yields from a 250ml culture is 300-500µg plasmid DNA.
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Mar 24 2025
Answer
Yes.
ABM Scientific Support
Answered on Mar 24 2025
ABM community
Verified customer
Asked on Jan 30 2026
Answer
Standard delivery of abm’s vectors are in liquid format supplied in TE buffer (10mM Tris, 1mM EDTA, pH 8.0). Our vectors can also be ordered and delivered in agar stabs for an additional fee.
ABM Scientific Support
Answered on Jan 30 2026
ABM community
Verified customer
Asked on Aug 08 2025
Answer
abm's lentiviral vectors are compatible with 2nd and 3rd generation packaging systems. We recommend abm’s Second Generation Packaging Mix (Cat. No. LV003) for users who want to achieve higher titer lentivirus as only 3 plasmids are required for virus production instead of 4 plasmids. We also recommend abm’s Third Generation Packaging Mix (Cat. No. LV053) for users concerned with virus biosafety, as the viral packaging elements are further split into 4 plasmids thus reducing probably of producing wild type virus.
Please note, only packaging mixes produced by abm have been tested in house and therefore carry our guarantee for high titer virus production. If it is desirable to use other packaging plasmids obtained from a different source, the compatibility must be tested and determined by the end user.
Please note, only packaging mixes produced by abm have been tested in house and therefore carry our guarantee for high titer virus production. If it is desirable to use other packaging plasmids obtained from a different source, the compatibility must be tested and determined by the end user.
ABM Scientific Support
Answered on Aug 08 2025
Prev
Next
There are currently no reviews for LG131126.
Please use the link above to contact us or submit feedback about this product.
×
Current vector selected:
MUC1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
Cat. No.
LG131126
Plasmid DNA Services
Midiprep Plasmid Amplification (3 Plasmids)
10-20 µg each
$225.00
Maxiprep Plasmid Amplification (3 Plasmids)
80-100 µg each
$450.00
3 Bacterial Agar Stabs
3 stabs
$120.00
Virus Packaging Services
Lentivirus packaging at 108 IU/ml Titer, set of 3 viruses (Mini)
3 x 250 µl per virus
$300.00
Lentivirus packaging at 109 IU/ml Titer, set of 3 viruses (Regular)
4 x 100 µl per virus
$900.00
Lentivirus packaging at 1010 IU/ml Titer, set of 3 viruses (Ultra-pure)
10 x 50 µl per virus
$2,200.00
Controls and Related Products
ViralEntry™ Transduction Enhancer (100X)
G515
1.0 ml
$190.00
DNAfectin™ Plus Transfection Reagent
G2500
1.0 ml
$245.00
CRISPR Scrambled sgRNA All-in-One AAV vector (with saCas9)
K070a
1.0 µg
$99.00
CRISPR Scrambled sgRNA All-in-One Lentiviral Vector (with spCas9)
K010
1.0 µg
$99.00
CRISPR Scrambled sgRNA All-in-One Non-Viral Vector (with spCas9)
K094
1.0 µg
$99.00
Empty
×
Current vector selected:
MUC1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
Cat. No.
LG131126
Controls and Related Products
ViralEntry™ Transduction Enhancer (100X)
G515
1.0 ml
$190.00
DNAfectin™ Plus Transfection Reagent
G2500
1.0 ml
$245.00
CRISPR Scrambled sgRNA All-in-One AAV vector (with saCas9)
K070a
1.0 µg
$99.00
CRISPR Scrambled sgRNA All-in-One Lentiviral Vector (with spCas9)
K010
1.0 µg
$99.00
CRISPR Scrambled sgRNA All-in-One Non-Viral Vector (with spCas9)
K094
1.0 µg
$99.00
Empty
×
The vector and the related service will be deleted together.
×
Add the Blank Control Vector to cart?
×
MUC1 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
LG131126
sgRNA only, set of 3
LG131126-LVgRNA
Lentivirus Packaging at 107 IU/ml Titer
CLV7-LG131126
Lentivirus Packaging at 108 IU/ml Titer
CLV8-LG131126
Lentivirus Packaging at 109 IU/ml Titer
CLV9-LG131126
Lentivirus Packaging at 1010 IU/ml Titer (Ultra-pure)
CLV10-LG131126